Save Full Webpage

Download entire web pages and save them as html file with urllib.request

You can use selenium instead to download full website nicely
Just run the following code

from selenium import webdriver
#Download the chrome driver from the link below and specify the path of chromedriver
#https://chromedriver.storage.googleapis.com/index.html?path=2.40/
chromedriver = 'C:/python36/chromedriver.exe'
url= 'https://asd.com/asdID='
for i in range(1, 5):
    browser = webdriver.Chrome(chromedriver)
    browser.get(url + str(i))
    data = browser.page_source
    with open("webpage%s.html" %(str(i)), "w+") as f:
        f.write(data)

UPDATE

from selenium.webdriver.firefox.firefox_binary import FirefoxBinary
import ahk

firefox = FirefoxBinary("C:\\Program Files (x86)\\Mozilla Firefox\\firefox.exe")
from selenium import webdriver

driver = web.Firefox(firefox_binary=firefox)
driver.get("http://www.yahoo.com")
ahk.start()
ahk.ready()
ahk.execute("Send,^s")
ahk.execute("WinWaitActive, Save As,,2")
ahk.execute("WinActivate, Save As")
ahk.execute("Send, C:\\path\\to\\file.htm")
ahk.execute("Send, {Enter}")

You will now get everything

Save complete web page (incl css, images) using python/selenium

As you noted, Selenium cannot interact with the browser's context menu to use Save as..., so instead to do so, you could use an external automation library like pyautogui.

pyautogui.hotkey('ctrl', 's')
time.sleep(1)
pyautogui.typewrite(SEQUENCE + '.html')
pyautogui.hotkey('enter')

This code opens the Save as... window through its keyboard shortcut CTRL+S and then saves the webpage and its assets into the default downloads location by pressing enter. This code also names the file as the sequence in order to give it a unique name, though you could change this for your use case. If needed, you could additionally change the download location through some extra work with the tab and arrow keys.

Tested on Ubuntu 18.10; depending on your OS you may need to modify the key combination sent.

Full code, in which I also added conditional waits to improve speed:

import time
from selenium import webdriver
from selenium.webdriver.common.by import By
from selenium.webdriver.support.expected_conditions import visibility_of_element_located
from selenium.webdriver.support.ui import WebDriverWait
import pyautogui

URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' #'GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGA'

# open page with selenium
# (first need to download Chrome webdriver, or a firefox webdriver, etc)
driver = webdriver.Chrome()
driver.get(URL)

# enter sequence into the query field and hit 'blast' button to search
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)

blast_button = driver.find_element_by_id("b1")
blast_button.click()

# wait until results are loaded
WebDriverWait(driver, 60).until(visibility_of_element_located((By.ID, 'grView')))

# open 'Save as...' to save html and assets
pyautogui.hotkey('ctrl', 's')
time.sleep(1)
pyautogui.typewrite(SEQUENCE + '.html')
pyautogui.hotkey('enter')

Save full webpage

You actually need to parse the html and all css files that are referenced, which is NOT easy. However a fast way to do it is to use an external tool like wget. After installing wget you could run from the command line
wget --no-parent --timestamping --convert-links --page-requisites --no-directories --no-host-directories -erobots=off http://example.com/mypage.html

This will download the mypage.html and all linked css files, images and those images linked inside css.
After installing wget on your system you could use php's system() function to control programmatically wget.

NOTE: You need at least wget 1.12 to properly save images that are references through css files.

How to download a full webpage with a Python script?

The following implementation enables you to get the sub-HTML websites. It can be more developed in order to get the other files you need. I sat the depth variable for you to set the maximum sub_websites that you want to parse to.

import urllib2
from BeautifulSoup import *
from urlparse import urljoin

def crawl(pages, depth=None):
    indexed_url = [] # a list for the main and sub-HTML websites in the main website
    for i in range(depth):
        for page in pages:
            if page not in indexed_url:
                indexed_url.append(page)
                try:
                    c = urllib2.urlopen(page)
                except:
                    print "Could not open %s" % page
                    continue
                soup = BeautifulSoup(c.read())
                links = soup('a') #finding all the sub_links
                for link in links:
                    if 'href' in dict(link.attrs):
                        url = urljoin(page, link['href'])
                        if url.find("'") != -1:
                                continue
                        url = url.split('#')[0] 
                        if url[0:4] == 'http':
                                indexed_url.append(url)
        pages = indexed_url
    return indexed_url

pagelist=["https://en.wikipedia.org/wiki/Python_%28programming_language%29"]
urls = crawl(pagelist, depth=2)
print urls

Python3 version, 2019. May this saves some time to somebody:

#!/usr/bin/env python

import urllib.request as urllib2
from bs4 import *
from urllib.parse  import urljoin

def crawl(pages, depth=None):
    indexed_url = [] # a list for the main and sub-HTML websites in the main website
    for i in range(depth):
        for page in pages:
            if page not in indexed_url:
                indexed_url.append(page)
                try:
                    c = urllib2.urlopen(page)
                except:
                    print( "Could not open %s" % page)
                    continue
                soup = BeautifulSoup(c.read())
                links = soup('a') #finding all the sub_links
                for link in links:
                    if 'href' in dict(link.attrs):
                        url = urljoin(page, link['href'])
                        if url.find("'") != -1:
                                continue
                        url = url.split('#')[0] 
                        if url[0:4] == 'http':
                                indexed_url.append(url)
        pages = indexed_url
    return indexed_url

pagelist=["https://en.wikipedia.org/wiki/Python_%28programming_language%29"]
urls = crawl(pagelist, depth=1)
print( urls )

How to save a web page snapshot with all its elements (css, js, images, ...) into one file

HTTrack, -%M

How to save all files from source code of a web site?

In Chrome, go to options (Customize and Control, the 3 dots/bars at top right) ---> More Tools ---> save page as

save page as  
filename     : any_name.html 
save as type : webpage complete.

Then you will get any_name.html and any_name folder.