Global and Local Variables in R

Global and local variables in R

Variables declared inside a function are local to that function. For instance:

foo <- function() {
    bar <- 1
}
foo()
bar

gives the following error: Error: object 'bar' not found.

If you want to make bar a global variable, you should do:

foo <- function() {
    bar <<- 1
}
foo()
bar

In this case bar is accessible from outside the function.

However, unlike C, C++ or many other languages, brackets do not determine the scope of variables. For instance, in the following code snippet:

if (x > 10) {
    y <- 0
}
else {
    y <- 1
}

y remains accessible after the if-else statement.

As you well say, you can also create nested environments. You can have a look at these two links for understanding how to use them:

1. http://stat.ethz.ch/R-manual/R-devel/library/base/html/environment.html
2. http://stat.ethz.ch/R-manual/R-devel/library/base/html/get.html

Here you have a small example:

test.env <- new.env()

assign('var', 100, envir=test.env)
# or simply
test.env$var <- 100

get('var') # var cannot be found since it is not defined in this environment
get('var', envir=test.env) # now it can be found

How to make a local variable global in R using Shiny?

Just create the variable outside any sub-function and update its value using <<-. This variable will be global per each session.

server <- function(input, output) {

  # init variable here
  algorithm_output <- NULL

  out_plots <- eventReactive(input$ok_input, {

    # to modify a global variable use <<- instead of <- or =
    algorithm_output <<- some_global_function(3, 2, 1)

    do.call("grid.arrange", c(algorithm_output$indexes, nrow=3))
  })

  output$indexes <- renderPlot({
    out_plots()
  })

  out_means <- eventReactive(input$ok_means, {
    k = as.integer(input$k)

    # you can get access to the updated value of your variable
    matplot(algorithm_output$means[[k-1]], type = "l", lty=1)

  })
  output$means <- renderPlot({
    out_means()
  })
}

How to define 'local' variables in R?

This answers illustrates the use of local within a loop in R:

    number <- 1:5
    res <- numeric(5)
    local(for(i in number){
 res2 <-res[i] + 42
  print(res2)
 })
[1] 42
[1] 42
[1] 42
[1] 42
[1] 42

The above does not create res2 in .GlobalEnv unlike the following:

 for(i in number){
  res2 <-res[i] + 42
  print(res2)
 }

Alternatively, you could avoid loops and use *apply and/or use functions that use local variables by design. See examples here

Global variables in R

As Christian's answer with assign() shows, there is a way to assign in the global environment. A simpler, shorter (but not better ... stick with assign) way is to use the <<- operator, ie

    a <<- "new" 

inside the function.

R function wont modify global variable

I think I know what is wrong

Change data <- table to data <<- table within your function

You are assigning the result to the local environment for the function, whilst the <<- will be assigning it to the global environment.

I would propose you try the following

library(rvest)
getData <- function(url) { html_table(read_html(url)) }

data <- getData("https://steemdb.com/accounts/reputation?page=1")

Or even better

library(rvest)
getData <- function(url) { html_table(read_html(url)) }
steemdb.url <-"https://steemdb.com/accounts/reputation?page=" 

data <- lapply(1:100, function(i) getData(paste0(steemdb.url, i)) )
data <- do.call(rbind, data)
View(data)

1:100 will get you the first 100 pages.

R global and local variable from loops

changing the line

b<<-a

into

b<<- get0("a", envir= parent.frame() )

should do it. However, please take note of Gregor's comment and see if this is really what you want.

Cant manipulate global/local variables inside a function in R

You forgot the dnastring <-

dna = c("A","G","C","T")

x =sample(dna,50,replace =TRUE)


dna_f = function(x){
  dnastring <- ""
  for (val in x){
    dnastring <- paste(dnastring,val,sep="")
    
  }
  return(dnastring)
  
}

Output:

> dna_f(x)
[1] "GGTCTGGCCGAACTACTGTACACCCCAAAGACAACGCCCCCGACGCTCTA"

Using global variable in function

Both <<- and assign will work:

myfunction <- function(var1, var2) {
   # Modification of global mydata
   mydata <<- ...
   # Alternatively:
   #assign('mydata', ..., globalenv())

   # Assign locally as well
   mydata <- mydata

   # Definition of another variable with the new mydata
   var3 <- ...

   # Recursive function
   mydata = myfunction(var2, var3)
}

That said, it’s almost always a bad idea to want to modify global data from a function, and there’s almost certainly a more elegant solution to this.

Furthermore, note that <<- is actually not the same as assigning to a variable in globalenv(), rather, it assigns to a variable in the parent scope, whatever that may be. For functions defined in the global environment, it’s the global environment. For functions defined elsewhere, it’s not the global environment.

---

Related Topics